BBa_K658008 1 BBa_K658008 position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) 2011-09-30T11:00:00Z 2015-05-08T01:13:02Z The promoter lux pR (BBa_R0062). The position 3&5 mutated promoter lux pR-3/5 is a product of site-directed mutagenesis of promoter lux pR (BBa_R0062). The promoter lux pR is based on the Vibrio fischeri quorum sensing gene promoters. The position 5 mutated promoter lux pR-3/5 gives a lower expression of downstream genes in an autoinduction system. In another word, the lux pR-3/5 has a lower efficiency than the lux pR(BBa_R0062). Similar to promoter lux pR, the expression is up-regulated by the action of LuxR protein combined with the signal molecule HSL. false false _835_ 0 10207 9 Not in stock false We have generated two point mutants by site-directed mutagenesis from the sequence of lux pR(BBa_R0062). In these mutants, the G residue of position 5 was changed to a C and the C residue of position 3 was changed to a T respectively. false Yidan Hu annotation2148176 1 LuxR/HSL range2148176 1 1 20 annotation2148175 1 K658008 range2148175 1 1 55 annotation2148172 1 start range2148172 1 53 53 annotation2148173 1 -35 range2148173 1 20 25 annotation2148174 1 -10 range2148174 1 42 47 BBa_K658008_sequence 1 acttctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z