BBa_K658007 1 lux pR-5 position 5 mutated promoter lux pR-5 (luxR & HSL regulated) 2011-09-30T11:00:00Z 2015-05-08T01:13:02Z The promoter lux pR (BBa_R0062). The position 5 mutated promoter lux pR-5 is a product of site-directed mutagenesis of promoter lux pR (BBa_R0062). The promoter lux pR is based on the Vibrio fischeri quorum sensing gene promoters. The position 5 mutated promoter lux pR-5 gives a higher expression of downstream genes in an autoinduction system. In another word, the lux pR-5 has a higher efficiency than the lux pR. Similar to promoter lux pR, the expression is up-regulated by the action of LuxR protein combined with the signal molecule HSL. false false _835_ 0 10207 9 Not in stock false By PCR method the G residue of position 5 was changed to a C based on the sequence of the promoter lux pR(BBa_R0062). false Yidan Hu annotation2148169 1 LuxR/HSL range2148169 1 1 20 annotation2148170 1 -35 range2148170 1 20 25 annotation2148171 1 -10 range2148171 1 42 47 annotation2148167 1 start range2148167 1 53 53 annotation2148168 1 K658007 range2148168 1 1 55 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1762 1 prefix range1762 1 1 2 annotation7039 1 BBa_C0062 range7039 1 1 756 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1764 1 T range1764 1 174 174 annotation1765 1 A range1765 1 492 492 annotation1766 1 luxR range1766 1 1 750 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC<sub>6</sub>HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1761 1 luxI range1761 1 1 579 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 annotation2213985 1 Help:Barcodes range2213985 1 619 643 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_F1610 1 BBa_F1610 3OC<sub>6</sub>HSL Sender Device 2003-12-04T12:00:00Z 2015-08-31T04:07:27Z Formerly I0461 Released HQ 2013 This device accepts PoPS as input and produces the LuxI enzyme. This enzyme produces 3OC<sub>6</sub>HSL. false true _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff component943133 1 BBa_B0034 component943160 1 BBa_B0012 component943150 1 BBa_B0010 component943143 1 BBa_C0061 annotation943150 1 BBa_B0010 range943150 1 670 749 annotation943160 1 BBa_B0012 range943160 1 758 798 annotation943143 1 BBa_C0061 range943143 1 19 636 annotation943133 1 BBa_B0034 range943133 1 1 12 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K658014 1 BBa_K658014 3OC6HSL Sender and Receiver Device with lux pR-5 Driven by PLlac 0-1 2011-10-01T11:00:00Z 2015-05-08T01:13:03Z F1610 K658000 Quorum sensing is used by a number of gram-negative bacterial genera to regulate expression of specific sets of genes in a cell density-dependent fashion. We constructed the part which expresses LuxI and LuxR upon induction by isopropyl-b-D-thiogalactopyranoside (IPTG). There are two regulatory genes involved in quorum sensing, the I and R genes. The I gene directs the synthesis of an acyl-homoserine lactone (AHL) signal molecule termed the autoinducer. The R gene codes for a transcription factor that is responsive to the N-acyl HSL signal. Cells are permeable to this signal, and thus high cell densities are required to achieve a critical concentration of the autoinducer required to bind the luxR product, which will be combined with lux pR and then the expression downstream genes could be started. Site-directed mutagenesis has been used to modify the promoter lux pR in this signalling device. We have generated three point mutants by site-directed mutagenesis, designated lux pR-3 (BBa_K658006), lux pR-5(BBa_K658007) and lux pR-3/5(BBa_K658008). This signalling device is usually used to connected with some protein coding sequence,The promoter lux pR-5 (BBa_K658007) at the end of this sequence regulates the expression of downstream genes. false false _835_ 0 10207 9 Not in stock false This signalling device is based on the quorum sensing system in V. Fischri. Different from an autoinduction system, this signalling circuit starts only at the presence of inducer IPTG which does not exist in the natural QS system. false Jie Chen component2295618 1 BBa_B0034 component2295594 1 BBa_R0011 component2295611 1 BBa_F1610 component2295637 1 BBa_K658007 component2295612 1 BBa_R0011 component2295621 1 BBa_C0062 component2295631 1 BBa_B0015 annotation2295611 1 BBa_F1610 range2295611 1 64 861 annotation2295631 1 BBa_B0015 range2295631 1 1740 1868 annotation2295637 1 BBa_K658007 range2295637 1 1877 1931 annotation2295612 1 BBa_R0011 range2295612 1 870 923 annotation2295618 1 BBa_B0034 range2295618 1 933 944 annotation2295621 1 BBa_C0062 range2295621 1 951 1706 annotation2295594 1 BBa_R0011 range2295594 1 1 54 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_F1610_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K658014_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K658007_sequence 1 acctctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z