BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC<sub>6</sub>HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7038 1 BBa_C0061 range7038 1 1 618 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation1760 1 LVA range1760 1 580 611 annotation1761 1 luxI range1761 1 1 579 BBa_K658015 1 BBa_K658015 3OC6HSL Sender and Receiver Device with lux pR-3/5 Driven by PLlac 0-1 2011-10-01T11:00:00Z 2015-05-08T01:13:03Z F1610 K658000 Quorum sensing is used by a number of gram-negative bacterial genera to regulate expression of specific sets of genes in a cell density-dependent fashion. We constructed the part which expresses LuxI and LuxR upon induction by isopropyl-b-D-thiogalactopyranoside (IPTG). There are two regulatory genes involved in quorum sensing, the I and R genes. The I gene directs the synthesis of an acyl-homoserine lactone (AHL) signal molecule termed the autoinducer. The R gene codes for a transcription factor that is responsive to the N-acyl HSL signal. Cells are permeable to this signal, and thus high cell densities are required to achieve a critical concentration of the autoinducer required to bind the luxR product, which will be combined with lux pR and then the expression downstream genes could be started. Site-directed mutagenesis has been used to modify the promoter lux pR in this signalling device. We have generated three point mutants by site-directed mutagenesis, designated lux pR-3 (BBa_K658006), lux pR-5(BBa_K658007) and lux pR-3/5(BBa_K658008). This signalling device is usually used to connected with some protein coding sequence,The promoter lux pR-5 (BBa_K658007) at the end of this sequence regulates the expression of downstream genes. false false _835_ 0 10207 9 Not in stock false This device is based on BBa_K658001. The RBS0.3 (BBa_B0032) in the killer protein producer regulate the expression of killer protein LacZalpha-ccdB. The higher strength a RBS has, the lower cell density may be got in the steady state. false Qianwen Gao component2295656 1 BBa_R0011 component2295681 1 BBa_K658008 component2295665 1 BBa_C0062 component2295655 1 BBa_F1610 component2295638 1 BBa_R0011 component2295662 1 BBa_B0034 component2295675 1 BBa_B0015 annotation2295655 1 BBa_F1610 range2295655 1 64 861 annotation2295665 1 BBa_C0062 range2295665 1 951 1706 annotation2295675 1 BBa_B0015 range2295675 1 1740 1868 annotation2295638 1 BBa_R0011 range2295638 1 1 54 annotation2295681 1 BBa_K658008 range2295681 1 1877 1931 annotation2295662 1 BBa_B0034 range2295662 1 933 944 annotation2295656 1 BBa_R0011 range2295656 1 870 923 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_F1610 1 BBa_F1610 3OC<sub>6</sub>HSL Sender Device 2003-12-04T12:00:00Z 2015-08-31T04:07:27Z Formerly I0461 Released HQ 2013 This device accepts PoPS as input and produces the LuxI enzyme. This enzyme produces 3OC<sub>6</sub>HSL. false true _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff component943133 1 BBa_B0034 component943143 1 BBa_C0061 component943150 1 BBa_B0010 component943160 1 BBa_B0012 annotation943143 1 BBa_C0061 range943143 1 19 636 annotation943160 1 BBa_B0012 range943160 1 758 798 annotation943150 1 BBa_B0010 range943150 1 670 749 annotation943133 1 BBa_B0034 range943133 1 1 12 BBa_K658008 1 BBa_K658008 position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) 2011-09-30T11:00:00Z 2015-05-08T01:13:02Z The promoter lux pR (BBa_R0062). The position 3&5 mutated promoter lux pR-3/5 is a product of site-directed mutagenesis of promoter lux pR (BBa_R0062). The promoter lux pR is based on the Vibrio fischeri quorum sensing gene promoters. The position 5 mutated promoter lux pR-3/5 gives a lower expression of downstream genes in an autoinduction system. In another word, the lux pR-3/5 has a lower efficiency than the lux pR(BBa_R0062). Similar to promoter lux pR, the expression is up-regulated by the action of LuxR protein combined with the signal molecule HSL. false false _835_ 0 10207 9 Not in stock false We have generated two point mutants by site-directed mutagenesis from the sequence of lux pR(BBa_R0062). In these mutants, the G residue of position 5 was changed to a C and the C residue of position 3 was changed to a T respectively. false Yidan Hu annotation2148176 1 LuxR/HSL range2148176 1 1 20 annotation2148175 1 K658008 range2148175 1 1 55 annotation2148174 1 -10 range2148174 1 42 47 annotation2148172 1 start range2148172 1 53 53 annotation2148173 1 -35 range2148173 1 20 25 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1765 1 A range1765 1 492 492 annotation1762 1 prefix range1762 1 1 2 annotation1764 1 T range1764 1 174 174 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation7039 1 BBa_C0062 range7039 1 1 756 annotation1766 1 luxR range1766 1 1 750 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation2001 1 lac O1 range2001 1 26 42 annotation7064 1 BBa_R0011 range7064 1 1 54 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K658008_sequence 1 acttctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_F1610_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K658015_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacttctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z