BBa_K660000 1 BBa_K660000 LOV2 Domain 2011-09-15T11:00:00Z 2015-05-08T01:13:03Z The LOV domain was originally isolated from Arabidopsis and has been codon optimised for expression in E.coli. The LOV (Light-Oxygen-Voltage) domain is a photoreceptor that responds to blue light. In nature it was first found to be involved in the phototropism response in plants and has since been found to be present in fungi and bacteria also. It has been shown to be coupled to many domains, for example phosphodiesterase or kinases. We are using it as a reporter due to its ability to function in anoxic conditions. This is particularly useful in biofilms and is a function that fluorescent proteins derived from GFP do not have. false false _837_ 0 9421 9 It's complicated true Illegal restriction sites were found so Site Directed Mutagenesis has to be performed. false Glasgow Uni 2011 annotation2135554 1 LOV2 domain range2135554 1 24 359 BBa_K660000_sequence 1 tcgctgaaggatccaagggtaccatgatcgagaagagctttgtgattaccgacccgcgtctgccggattatccgatcatcttcgccagcgatggttttctggagctgaccgagtatagccgtgaagagattatgggccgtaatgcgcgtttcttgcagggtccagaaaccgaccaagcgacggtccagaaaatccgtgacgcaattcgcgatcaacgcgaaaccactgttcagttgatcaattacacgaagtctggcaaaaagttttggaacctgctgcatctgcaaccggtccgtgatcgcaaaggcggtctgcagtacttcattggtgtgcaactggttggttccgaccacgtttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z