BBa_K660004 1 BBa_K660004 iLOV 2011-09-15T11:00:00Z 2015-05-08T01:13:03Z iLOV is a version of LOV2 that has been altered through site directed mutagenesis and DNA shuffling. Released HQ 2013 iLOV has the same function and uses as LOV2. As a reporter, it is advantageous over GFP derived fluorescent proteins due to its small size (useful if you are tagging proteins), ability to recover quickly from photobleaching and use in anoxic conditions. false false _837_ 0 9421 9 In stock true illegal restriction sites. The part was synthesized to remove them. false Glasgow Uni 2011 annotation2135615 1 iLOV Domain range2135615 1 1 336 BBa_K660004_sequence 1 atgattgaaaaaaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatggctttctggaactgaccgaatatagccgtgaagaaattctgggccgtaacgcgcgttttttgcagggcccggaaaccgatcaggcgaccgtgcagaaaattcgtgatgcgattcgtgatcagcgtgaaaccaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgctgcatttgcagccggtgcgtgatcagaaaggcgaattgcagtattttattggcgtgcagctggatggcagcgatcatgtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z