BBa_K660500 1 BBa_K660500 Multiple Cloning Site (MCS) 2011-09-19T11:00:00Z 2015-05-08T01:13:03Z Synthesised This BioBrick contains Multiple Cloning Site. Using this BioBrick a gene can be tested in a construct even before putting it into BioBrick format. This way a lot of time can be saved, in a case when a construct does not work. false false _837_ 0 9433 9 Not in stock false It needed to contain multiple restriction sites false Glasgow Uni 2011 BBa_K660500_sequence 1 ggtaccggcgccctcgagggatccaagctttactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z