BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K660600 1 BBa_K660600 Bluf Promoter + Strong RBS 2011-09-20T11:00:00Z 2015-05-08T01:13:03Z Uses Bluf from registry and Strong RBS from registry Composite of the Bluf promoter + Strong RBS false false _837_ 0 9421 9 It's complicated false Small size of RBS - used method detailed on our wiki (AlwnI) false Glasgow Uni 2011 component2136957 1 BBa_K238013 component2136959 1 BBa_B0034 annotation2136957 1 BBa_K238013 range2136957 1 1 86 annotation2136959 1 BBa_B0034 range2136959 1 95 106 BBa_K238013 1 BLp Exact promoter of the blue light receptor 2009-08-01T11:00:00Z 2015-05-08T01:11:36Z E.coli strain MC4100 ycgF/E regulated promoter region ycgf is a cytoplasmic receptor which responds to blue light. it contains a Blue light Using FAD-Domain (BLUF) and an EAL domain. when blue light strikes, the receptor changes conformation and dimerizes. This allows it to bind to ycgE repressor through its EAL-domain releasing the repressor from this promoter region. See reference for more info: Natalia Tschowri, Susan Busse and Regine Hengge, The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli. Genes and development23: 522-534 (2009) false false _332_ 0 4771 9 It's complicated true none false Annelien Verfaillie annotation2014612 1 inverted repeat part 1 range2014612 1 53 59 annotation2014611 1 spacer range2014611 1 34 51 annotation2014609 1 -35 box range2014609 1 28 33 annotation2014613 1 inverted repeat part 2 range2014613 1 67 73 annotation2014614 1 transcription start range2014614 1 64 65 annotation2014610 1 -10 box range2014610 1 52 58 BBa_B0034_sequence 1 aaagaggagaaa BBa_K238013_sequence 1 attgcaaaaaattaatttatcattctgtacacatatttcgtacaagtttgctattgttacttcacttaacattgattaacattttt BBa_K660600_sequence 1 attgcaaaaaattaatttatcattctgtacacatatttcgtacaagtttgctattgttacttcacttaacattgattaacattttttactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z