BBa_K669003 1 BBa_K669003 CBP promoter 2011-09-27T11:00:00Z 2015-05-08T01:13:03Z Vibrio fischeri ES114 Chitooligosaccharide-Binding Protein (CBP) is a cytoplasmatic protein that regulates the transcriptional activity of the ChiS sensor. When chitin is present in the external media, CBP binds with GlcNAc oligomers (chitin degradation products) and liberates the sensor for the up-regulation of the chitinolitic degradation cascade in Vibrio fischeri ES114. This promoter part enables transcriptional characterization of CBP expression. false false _851_ 0 9809 9 It's complicated true Amplified by PCR from V. fischeri ES114. false Silvia J Ca??as annotation2146522 1 Incomplete CBP ORF range2146522 1 87 118 annotation2146518 1 CBP promoter range2146518 1 1 86 BBa_K669003_sequence 1 tttgaggtaagcctttaatgtgtgtttatcaaattgataaagacgtatatatcgtgaaactaaagcaaagagtaaggaacagctatgcttgccaatattaaaaaaactacattagctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z