BBa_K726003 1 BBa_K726003 T7 promoter + lac operator + His tag 2012-08-08T11:00:00Z 2015-05-08T01:13:05Z The sequence is from pCDFDuet from Novagen. T7 promoter is good for protein expression in <i>e. coli</i>. Requires the T7 RNA polymerase. Also contains a RBS, and a His tag for protein purification. Insert your protein of interest behind this. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179384 1 T7 promoter range2179384 1 1 17 annotation2179473 1 lac operator range2179473 1 22 42 annotation2179385 1 His tag range2179385 1 100 117 BBa_K726003_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z