BBa_K726003 1 BBa_K726003 T7 promoter + lac operator + His tag 2012-08-08T11:00:00Z 2015-05-08T01:13:05Z The sequence is from pCDFDuet from Novagen. T7 promoter is good for protein expression in <i>e. coli</i>. Requires the T7 RNA polymerase. Also contains a RBS, and a His tag for protein purification. Insert your protein of interest behind this. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179385 1 His tag range2179385 1 100 117 annotation2179473 1 lac operator range2179473 1 22 42 annotation2179384 1 T7 promoter range2179384 1 1 17 BBa_K726005 1 BBa_K726005 T7 driven lac operated produced antitoxin relB 2012-08-09T11:00:00Z 2015-05-08T01:13:05Z The T7 promoter and lac operator is from the plasmid pCDFDuet from Novagen. The antitoxin is from the e. coli genome. Antitoxin relB production driven by a T7 promoter (requires T7 RNA polymerase), inducable by lactose/lactose substitute. Also contains RBS and a His tag. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu component2179480 1 BBa_K726004 component2179478 1 BBa_K726003 annotation2179478 1 BBa_K726003 range2179478 1 1 129 annotation2179480 1 BBa_K726004 range2179480 1 136 375 BBa_K726004 1 BBa_K726004 RelB 2012-08-09T11:00:00Z 2015-05-08T01:13:05Z The part is from the e. coli genome. part of a toxin-antitoxin system. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179474 1 relB range2179474 1 1 240 BBa_K726005_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccgtactagatgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgcttgaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgacaatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggagatagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactctga BBa_K726003_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccg BBa_K726004_sequence 1 atgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgcttgaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgacaatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggagatagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z