BBa_C0070 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3476 Released HQ 2013 Autoinducer synthesis protein that produces N-butyryl-HSL which binds to RhlR, obtained from Pseudomonas aeruginosa. false false _1_ 0 24 7 In stock false Editing Check (1/28/04) (0) BB sites cleaned (1) ATG (2) TAATAA (3) Blast checks out (i.e., it's RhlI) (4) Codon changes OK (AA and tRNA usage) (5) Chassis might have conflict (w/ native autoinducer system?) (6) ssrA tag added (7) barcode added (8) Codon optimized for expression in enteric bacteria <P> 2 silent point mutations have been included into the sequence at base 138 from A to G and at base 576 from G to C to remove internal EcoRI and PstI sites. Mutations were chosen to yield the same amino acid and codons of similar frequency in E. coli. true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation301203 1 rhlL range301203 1 1 603 annotation306820 1 LVA range306820 1 604 636 annotation2213996 1 Help:Barcodes range2213996 1 643 667 BBa_K726008 1 BBa_K726008 T7 driven lac operated inducer for the rhl quorum-sensing system 2012-08-09T11:00:00Z 2015-05-08T01:13:05Z The inducer is from the parts registry. The T7 promoter and lac operator is from the plasmid pCDFDuet from Novagen. Produces the chemical signal N-butyryl-HSL. Induces pRhl with the regulatory protein RhlR. Requires the T7 RNA polymerase and inducable by the lactose. false true _972_ 0 10304 9 Not in stock false None. false Sami Chu component2244971 1 BBa_C0070 component2244967 1 BBa_K726003 annotation2244971 1 BBa_C0070 range2244971 1 136 802 annotation2244967 1 BBa_K726003 range2244967 1 1 129 BBa_K726003 1 BBa_K726003 T7 promoter + lac operator + His tag 2012-08-08T11:00:00Z 2015-05-08T01:13:05Z The sequence is from pCDFDuet from Novagen. T7 promoter is good for protein expression in <i>e. coli</i>. Requires the T7 RNA polymerase. Also contains a RBS, and a His tag for protein purification. Insert your protein of interest behind this. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179385 1 His tag range2179385 1 100 117 annotation2179384 1 T7 promoter range2179384 1 1 17 annotation2179473 1 lac operator range2179473 1 22 42 BBa_K726008_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccgtactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0070_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K726003_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z