BBa_K726006 1 BBa_K726006 YefM 2012-08-09T11:00:00Z 2015-05-08T01:13:05Z This part is from the e. coli genome. antitoxin of the yefM-yoeB toxin-antitoxin system. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179481 1 yefM range2179481 1 1 252 BBa_K726012 1 BBa_K726012 T7Prom+HisTag+YefM 2012-10-01T11:00:00Z 2015-05-08T01:13:05Z YefM was cloned from E. coli gDNA and the rest of the part is from the Novagen pcdfDuet plasmid. This part contains YefM the antitoxin of the yefM-yoeB toxin-antitoxin system. It is behind a T7 Promoter with a , lac operator, ribosome binding site, and 6x his tag. The construct can be moved to any plasmid for expression. false false _972_ 0 10295 9 In stock false n/a false Kendall Kearns component2206589 1 BBa_K726003 component2206591 1 BBa_K726006 annotation2206591 1 BBa_K726006 range2206591 1 130 381 annotation2206589 1 BBa_K726003 range2206589 1 1 129 BBa_K726003 1 BBa_K726003 T7 promoter + lac operator + His tag 2012-08-08T11:00:00Z 2015-05-08T01:13:05Z The sequence is from pCDFDuet from Novagen. T7 promoter is good for protein expression in <i>e. coli</i>. Requires the T7 RNA polymerase. Also contains a RBS, and a His tag for protein purification. Insert your protein of interest behind this. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179385 1 His tag range2179385 1 100 117 annotation2179473 1 lac operator range2179473 1 22 42 annotation2179384 1 T7 promoter range2179384 1 1 17 BBa_K726012_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccgatgcgtacaattagctacagcgaagcgcgtcagaatttgtcggcaacaatgatgaaagccgttgaagatcatgccccgatccttattactcgtcagaatggagaggcttgtgttctgatgtcactcgaagaatacaactcgctggaagagacggcttatctactgcgctcccccgctaacgcccggagattgatggactcaatcgatagcctgaaatcaggcaaaggaacggaaaaggacatcattgagtga BBa_K726003_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccg BBa_K726006_sequence 1 atgcgtacaattagctacagcgaagcgcgtcagaatttgtcggcaacaatgatgaaagccgttgaagatcatgccccgatccttattactcgtcagaatggagaggcttgtgttctgatgtcactcgaagaatacaactcgctggaagagacggcttatctactgcgctcccccgctaacgcccggagattgatggactcaatcgatagcctgaaatcaggcaaaggaacggaaaaggacatcattgagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z