BBa_K118011 1 BBa_K118011 PcstA (glucose-repressible promoter) 2008-08-18T11:00:00Z 2015-05-08T01:09:36Z ''Eschaerichia coli'' JM109 genomic DNA Released HQ 2013 This is the promoter for the ''Eschaerichia coli'' JM109 ''cstA'' gene. It includes the CRP-binding site and the RNA polymerase-binding site. Low glucose concentration results in increased activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to associate with the promoter and promote transcription of the downstream gene. (''cstA'' encodes the carbon starvation protein.) false true _192_ 0 3282 9 In stock true No special considerations true Andrew Hall annotation1972435 1 cAMP receptor protein binding site range1972435 1 1 42 annotation1972436 1 RNA polymerase binding site range1972436 1 101 131 BBa_K729015 1 BBa_K729015 pcstA+RBS+T7RNAP 2012-09-12T11:00:00Z 2015-05-08T01:13:06Z E.coli Released HQ 2013 This divice contains a glucose-repressible promoter ([http://partsregistry.org/Part:BBa_K118011 Part:BBa_K118011]) ligated with a GFP generator ([http://partsregistry.org/Part:BBa_E0840 Part:BBa_E0840]). Low glucose concentration promotes the transcription of the GFP as the complex between cAMP and CRP binds the cstA promoter. true false _975_ 0 13561 9 Discontinued false - false Erick Miguel Ramos-Martinez annotation2185226 1 RNA polymerase binding site range2185226 1 101 131 annotation2185227 1 BBa_K118011 range2185227 1 1 131 annotation2185225 1 cAMP receptor protein binding site range2185225 1 1 42 BBa_K118011_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggaca BBa_K729015_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z