BBa_K731721 1 BBa_K731721 T7 terminator 2012-08-14T11:00:00Z 2015-05-08T01:13:06Z We amplified it directly from pET21b. Released HQ 2013 This is a short terminator by T7phage that we tested with our new teminators' characterization system. false false _977_ 0 12063 9 In stock true This is a standard sequence, very used in many constructs. As i don't have any design considerations i can say that generally to make screening gels of such short segments is preferable to use TBE1X instead of TAE1X. false Giacomo Giacomelli, Anna Depetris annotation2180632 1 T7 terminator range2180632 1 1 48 BBa_K731721_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z