BBa_K731722 1 BBa_K731722 T1 terminator from E. coli rrnB 2012-08-22T11:00:00Z 2015-05-08T01:13:06Z This part comes from B0012 contained in E0840, a double terminator in which B0010 is the second one. We used an extraction PCR. Released HQ 2013 This is the B0010 part extracted by PCR from the doulbe terminator B0012. We didn't manage to extract it directly from the registry and we discovered that others had the same problem; for this reason we are submitting it once again, confirmed by sequencing and by experience...ready to use! The characterization has been done both with T7 and Coli RNApolymerases. false false _977_ 0 12063 9 In stock true I don't have any design considerations, anyway it is useful to use TBE1X instead of TAE1X to make screening gels of such small fragments. false Anna Depetris, Giacomo Giacomelli annotation2180631 1 B0010 range2180631 1 1 79 BBa_K731722_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z