BBa_K732000 1 hCG-β Human Chorionic Gonadotropin, Beta Subunit (hCG-β) 2012-09-30T11:00:00Z 2015-05-08T01:13:06Z The sequence of hCG-beta in the human genome has been known since 1980, and the physical DNA was acquired from a plasmid from the Vogelstein lab through addgene.org. Human chorionic gonadotropin (hCG) is a hormone produced during pregnancy. Its beta subunit (hCG-β) contains epitopes recognized by pregnancy tests. The full hCG dimer is also used as an ovulation inducer and can stimulate the production of testosterone in men. This sequence can be used to express hCG for any downstream uses, and also as an output signal since it triggers pregnancy tests at low concentrations when properly folded. false false _978_ 0 9227 9 It's complicated false Added BioBrick prefix and suffix to native human protein-coding sequence. false Joshua Fass BBa_K732000_sequence 1 atgggcatggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctccccccagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z