BBa_K732001 1 synCG Synthetic Chorionic Gonadotropin, beta (synCG-β) 2012-09-30T11:00:00Z 2015-05-08T01:13:06Z The sequence of hCG-beta in the human genome has been known since 1980. Starting from a consensus protein sequence on NCBI, we codon-optimized the sequence using GeneDesigner. A synthetic version of human chorionic gonadotropin (hCG), a hormone produced during pregnancy. The nucleotide sequence was modified to maximize expression efficiency in bacteria and to conform to standard assembly, and the gene was chemically synthesized. The protein coded by this part is the beta subunit of hCG (hCG-β), which contains epitopes recognized by pregnancy tests. The full hCG dimer is also used as an ovulation inducer and can stimulate the production of testosterone in men. This sequence can be used to express hCG for any downstream uses, and also as an output signal since it triggers pregnancy tests at low concentrations when properly folded. false false _978_ 0 9227 9 It's complicated false Started with NCBI???s protein consensus sequence, and then codon-optimized for expression in Bordetella subspecies, removed all illegal and strongly-preferred-absent cut sites, and corrected for hairpins and GC content. During the design process, we codon-optimized for several Bordetella subspecies and E. coli using GeneDesigner codon tables and noted that the resulting sequences were highly conserved. For ease of synthesis, synonymous codons of slightly lower usage bias were used in some cases to reduce GC content and avoid hairpin structures. false Joshua Fass BBa_K732001_sequence 1 atggagatgttccagggcctgctgctgctgctgctgctgagcatgggcggcacctgggccagcaaggagccgctgcgcccgcgctgccgcccgatcaacgccaccctggccgtggagaaggagggctgcccggtgtgcatcaccgtgaacaccaccatctgcgccggctactgcccgaccatgacccgcgtgctccagggcgtgctgccggccctgccgcaggtggtgtgcaactaccgcgacgtgcgcttcgagagcatccgcctgccgggctgcccgcgcggcgtgaacccggtggtgagctacgccgtggccctgtcgtgccagtgcgccctgtgtcgtcgttcgaccaccgactgcggcggcccgaaggaccacccgttgacctgcgacgacccgcgtttccaggacagcagcagcagcaaggccccgccgccgagcctgccgagcccgagccgtttgccgggcccgagcgacaccccgattctgccgcagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z