BBa_K733001 1 BBa_K733001 <i>Ptms</i> - a constitutive promoter in <i>E. coli</i> and <i>B. subtilis</i>. 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false GU, Bida; SUN Fei annotation2193570 1 Sigma A binding sequence, -10 range2193570 1 40 46 annotation2193526 1 Sigma A binding sequence, -35 range2193526 1 14 20 BBa_K733001_sequence 1 catgaagtctccttgaaatcagaagatatttaggatatatttttctatggataaaagggatattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z