BBa_K733013 1 BBa_K733013 <i>Pveg</i>+R.B.S. 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris, Yu lai cheong component2183794 1 BBa_K316001 component2183796 1 BBa_K143021 annotation2183796 1 BBa_K143021 range2183796 1 98 109 annotation2183794 1 BBa_K316001 range2183794 1 1 97 BBa_K733006 1 BBa_K733006 <i>ydjM</i>+<i>Bmp2</i> 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris Yu Lai Cheong; LI Yiming annotation2193746 1 Mature BMP-2 range2193746 1 114 461 annotation2193745 1 Signal Peptide, YdjM range2193745 1 1 113 BBa_K733014 1 BBa_K733014 <i>Pveg</i>+RBS+<i>ydjM</i>+<i>Bmp2</i> 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris Yu Lai Cheong; LI Yiming component2183804 1 BBa_K733006 component2183803 1 BBa_K733013 annotation2183803 1 BBa_K733013 range2183803 1 1 109 annotation2183804 1 BBa_K733006 range2183804 1 118 578 BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K733006_sequence 1 tcctagatgttaacaaacagggggacgaaatgttgaagaaagtcattttagccgcttttatcttagtaggaagtactttgggagcttttagtttttcatcagatgccagtgcgcaagccaaacacaaacagcggaagcgcctcaagtccagctgcaagagacaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcacctccgggctatcatgccttttactgccatggggagtgtccttttccccttgctgaccacctgaactccactaaccatgccatagtgcagactctggtgaactctgtgaactccaaaatccctaaggcatgctgtgtccccacagagctcagcgcaatctccatgttgtacctagatgaaaatgaaaaggttgtgctaaaaaattatcaggacatggttgtggagggctgcgggtgtcgttaataa BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K143021_sequence 1 aaaggtggtgaa BBa_K733013_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaa BBa_K733014_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaatactagagtcctagatgttaacaaacagggggacgaaatgttgaagaaagtcattttagccgcttttatcttagtaggaagtactttgggagcttttagtttttcatcagatgccagtgcgcaagccaaacacaaacagcggaagcgcctcaagtccagctgcaagagacaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcacctccgggctatcatgccttttactgccatggggagtgtccttttccccttgctgaccacctgaactccactaaccatgccatagtgcagactctggtgaactctgtgaactccaaaatccctaaggcatgctgtgtccccacagagctcagcgcaatctccatgttgtacctagatgaaaatgaaaaggttgtgctaaaaaattatcaggacatggttgtggagggctgcgggtgtcgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z