BBa_K733015 1 BBa_K733015 <i>Pveg</i>+RBS+<i>ybdN</i>+<i>Bmp2</i> 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris Yu Lai Cheong; LI Yiming component2183811 1 BBa_K733005 component2183810 1 BBa_K733013 annotation2183810 1 BBa_K733013 range2183810 1 1 109 annotation2183811 1 BBa_K733005 range2183811 1 118 556 BBa_K733017 1 BBa_K733017 <i>Pveg</i>+RBS+<i>ybdN</i>+<i>Bmp2</i>+terminator 2012-09-15T11:00:00Z 2015-05-08T01:13:07Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris Yu Lai Cheong; LI Yiming component2183841 1 BBa_B0015 component2183834 1 BBa_K733015 annotation2183834 1 BBa_K733015 range2183834 1 1 556 annotation2183841 1 BBa_B0015 range2183841 1 565 693 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K733005 1 BBa_K733005 <i>ybdN</i>+<i>Bmp2</i> 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris Yu Lai Cheong; LI Yiming annotation2193711 1 Mature BMP-2 range2193711 1 92 439 annotation2193710 1 Signal Peptide, YbdN range2193710 1 1 91 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K733013 1 BBa_K733013 <i>Pveg</i>+R.B.S. 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris, Yu lai cheong component2183794 1 BBa_K316001 component2183796 1 BBa_K143021 annotation2183796 1 BBa_K143021 range2183796 1 98 109 annotation2183794 1 BBa_K316001 range2183794 1 1 97 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K733005_sequence 1 aaaggaggttgtttgcatggtgaaaaaatggcttattcaattcgctgttatgctttctgtcttatctacctttacgtattcggcatcagctcaagccaaacacaaacagcggaagcgcctcaagtccagctgcaagagacaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcacctccgggctatcatgccttttactgccatggggagtgtccttttccccttgctgaccacctgaactccactaaccatgccatagtgcagactctggtgaactctgtgaactccaaaatccctaaggcatgctgtgtccccacagagctcagcgcaatctccatgttgtacctagatgaaaatgaaaaggttgtgctaaaaaattatcaggacatggttgtggagggctgcgggtgtcgttaataa BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K143021_sequence 1 aaaggtggtgaa BBa_K733017_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaatactagagaaaggaggttgtttgcatggtgaaaaaatggcttattcaattcgctgttatgctttctgtcttatctacctttacgtattcggcatcagctcaagccaaacacaaacagcggaagcgcctcaagtccagctgcaagagacaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcacctccgggctatcatgccttttactgccatggggagtgtccttttccccttgctgaccacctgaactccactaaccatgccatagtgcagactctggtgaactctgtgaactccaaaatccctaaggcatgctgtgtccccacagagctcagcgcaatctccatgttgtacctagatgaaaatgaaaaggttgtgctaaaaaattatcaggacatggttgtggagggctgcgggtgtcgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K733013_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K733015_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaatactagagaaaggaggttgtttgcatggtgaaaaaatggcttattcaattcgctgttatgctttctgtcttatctacctttacgtattcggcatcagctcaagccaaacacaaacagcggaagcgcctcaagtccagctgcaagagacaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcacctccgggctatcatgccttttactgccatggggagtgtccttttccccttgctgaccacctgaactccactaaccatgccatagtgcagactctggtgaactctgtgaactccaaaatccctaaggcatgctgtgtccccacagagctcagcgcaatctccatgttgtacctagatgaaaatgaaaaggttgtgctaaaaaattatcaggacatggttgtggagggctgcgggtgtcgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z