BBa_K734002 1 BBa_K734002 Spinach Aptamer with Stabilizing tRNA Scaffold 2012-08-21T11:00:00Z 2015-05-08T01:13:07Z Generated from SELEX. The fluorescent Spinach Aptamer (SpA) created by the Jaffrey Lab at Cornell University, designed to bind to the GFP-like synthetic fluorophore, 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI). SpA generates a green fluorescence upon binding DFHBI after transcription into mRNA. As reported by the Jaffrey group; excitation wavelength: 469 nm, emission wavelength: 501, with 53% EGFP fluorescent strength. false false _983_ 0 13725 9 Not in stock false false Logan Bachman annotation2180552 1 tRNA Scaffold (left) range2180552 1 1 30 annotation2180553 1 tRNA Scaffold (right) range2180553 1 111 145 annotation2180554 1 Spinach RNA Aptamer range2180554 1 31 110 BBa_K734002_sequence 1 gaagcggtggctcaatggtagagctttcgagacgcgaccgaaatggtgaaggacgggtccagtgcttcggcactgttgagtagagtgtgagctccgtaactggtcgcgtctcgaagggttgcaggttcaattcctgtccgtttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z