BBa_K737007 1 BBa_K737007 Constitutive GVPC Generator 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes. Released HQ 2013 "It contains a constitutive promoter, GvpC protein , GFP protein and a terminator. This part can be used as a control of (J23106+P0440+R0040+B0034+GVPC+E0840). It can express GvpC protein and GFP constantly. When it transformed with (J23106+P0412+R0011+B0034+GVPA+E0840), the bacteria may can float with GFP!" false false _986_ 0 14291 9 In stock false This part can be used as a control of (J23106+P0440+R0040+B0034+GVPC+E0840). It can express GvpC protein and GFP constantly. When it transformed with (J23106+P0412+R0011+B0034+GVPA+E0840), the bacteria may can float with GFP. false Li Kang component2184890 1 BBa_J23106 component2184893 1 BBa_K737017 component2184892 1 BBa_B0034 component2184904 1 BBa_E0840 annotation2184890 1 BBa_J23106 range2184890 1 1 35 annotation2184892 1 BBa_B0034 range2184892 1 44 55 annotation2184893 1 BBa_K737017 range2184893 1 62 565 annotation2184904 1 BBa_E0840 range2184904 1 574 1451 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_E0840 1 GFP genera GFP generator 2004-10-17T11:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 B0030.E0040.B0015 false true _11_1_ 0 61 7 In stock true true Jennifer Braff component1249247 1 BBa_B0010 component1249239 1 BBa_B0030 component1249242 1 BBa_E0040 component1249257 1 BBa_B0012 annotation1249242 1 BBa_E0040 range1249242 1 22 741 annotation1249257 1 BBa_B0012 range1249257 1 838 878 annotation1249239 1 BBa_B0030 range1249239 1 1 15 annotation1249247 1 BBa_B0010 range1249247 1 750 829 BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K737007_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaatactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_E0840_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z