BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737019 1 BBa_K737019 Cyanobacteria gene promoter 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Cyanobacteria gene promoter Cyanobacteria gene promoter which structure similar with Escherichia coli promoter but it Strength weak in Escherichia coli promoter. false false _986_ 0 14291 9 Not in stock false No. false Tianhe Wang BBa_K737020 1 BBa_K737020 Cyanobacteria gene ribosome binding site 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z It's Cyanobacteria gene ribosome banding site Cyanobacteria gene promoter which structure similar with Escherichia coli promoter but it Strength more weak in Escherichia coli promoter only five basic group. false true _986_ 0 14291 9 It's complicated false No false Tianhe Wang BBa_K737010 1 BBa_K737010 Gvp cluster 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes. This 1 kbp part contains 2 open reading frames coding for gas vesicle genes (gvpA gvpC-20) from Bacillus Planktothrix rubescens strain BC-Pla 9402. Promotion of the sequence results in expression of gas vesicles, organelles made entirely out of protein. These organelles contain gas and therefore provide bouyancy to the cell. This slows the rate of settling of the cells in different water layer from Lake Zurich by gas vesicles, see??Walsby 2002 false false _986_ 0 14291 9 It's complicated true We referred to the paper:Spontaneous mutations in gas vesicle genes of Planktothrix spp. a??ect gas vesicle production and critical pressure Steven J. Beard, Barbara A. Handley, Anthony E. Walsby FEMS Microbiology Letters 215 (2002) 189^195 false Tianhe Wang component2198977 1 BBa_K737020 component2198978 1 BBa_K737016 component2198981 1 BBa_K737017 component2198988 1 BBa_B0015 component2198980 1 BBa_K737020 component2198979 1 BBa_K737019 component2198976 1 BBa_K737019 annotation2198979 1 BBa_K737019 range2198979 1 293 338 annotation2198978 1 BBa_K737016 range2198978 1 66 284 annotation2198977 1 BBa_K737020 range2198977 1 55 59 annotation2198976 1 BBa_K737019 range2198976 1 1 46 annotation2198981 1 BBa_K737017 range2198981 1 358 861 annotation2198988 1 BBa_B0015 range2198988 1 870 998 annotation2198980 1 BBa_K737020 range2198980 1 347 351 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K737016 1 BBa_K737016 This part conteins gvpA protein's coding sequence. 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes. This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737019_sequence 1 attcactgcccatacccaatgcccagaaatgcacaacccactgaca BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K737020_sequence 1 aggag BBa_K737016_sequence 1 atggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaa BBa_K737010_sequence 1 attcactgcccatacccaatgcccagaaatgcacaacccactgacatactagagaggagtactagatggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaatactagagattcactgcccatacccaatgcccagaaatgcacaacccactgacatactagagaggagtactagatggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z