BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z