BBa_K737019 1 BBa_K737019 Cyanobacteria gene promoter 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Cyanobacteria gene promoter Cyanobacteria gene promoter which structure similar with Escherichia coli promoter but it Strength weak in Escherichia coli promoter. false false _986_ 0 14291 9 Not in stock false No. false Tianhe Wang BBa_K737019_sequence 1 attcactgcccatacccaatgcccagaaatgcacaacccactgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z