BBa_K737031 1 BBa_K737031 Spot42 based small RNA1 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z No Released HQ 2013 Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose operon and other sugar metabolic pathway,such as galK,nanC,ytfJ,srlA,which are the 5??? leader sequence of the corresponding metabolic enzymes. Take galK for example,Spot42 causes translation repression by base pairing to RBS in the 5??? leader sequence,then block the recognition of the antiSD sequence on 30S subunit. It???s a very strong pairing(up to 20bases),but it only causes 2.6 fold repression according to Johannes H. Urban and Jo?? rg Vogel,for it doesn???t result in the degradation of the RNA complex by RNaseE(ssRNA degradation) and RNaseIII(dsRNA degradation),both of them are major enzymes that causes RNA degradation in vivo.Spot42-galK complex degrades in a slow and presently unclear way. The base pairing is initiated by the recognition of seed region,which plays a significant role in the repression efficiency. false false _986_ 0 14291 9 In stock false No false Peiran Zhang and Minghao Gong BBa_K737031_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacaatcgatggtcgacgtagggtacagaggtaagatgttctatctttcagaccttttacttcacgtaatcggatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z