BBa_K737033 1 BBa_K737033 galK is the leader sequence of galactokinase (GalK) 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Reference: [1] Johannes H. Urban and Jo?? rg Vogel, Translational control and target recognition by Escherichia coli small RNAs in vivo, Nucleic Acids Research, 2007, Vol. 35, No. 3 [2] Boris G??rke and J??rg Vogel, Noncoding RNA control of the making and breaking of sugars, GENES & DEVELOPMENT 22:2914???2925 ,2008 Released HQ 2013 galK is the leader sequence of galactokinase (GalK),and Spot42 sRNA controls the synthesis of the galactokinase (GalK) in response to the availability of glucose in the environment,by blocking the recognition of antiSD motif to RBS.The repression is modest(about 2.6 fold),maybe there is no subsequent degradation caused by the major degradosome,RNaesE and RNaseIII. Note:The ClaI site is blocked by GATC methylation due to a mistake.It should be amplified by PCR to get rid of dam methylation before ClaI degestion false false _986_ 0 14291 9 In stock false No false Peiran Zhang BBa_K737033_sequence 1 gtcgacagtcagcgatatccattttcgcgaatccggagtgtaagaaatgagtctgaaagaaaaaacacaatctctgtttgccaacgcatttggctaccctgccactcacaccattcaggcgatcgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z