BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K737042 1 BBa_K737042 constitutive Spot42 generator ligated to TetR generator 2012-09-18T11:00:00Z 2015-05-08T01:13:07Z No [J23106,P0440]is a TetR generator, which represses tet promotor and can be induced by aTc. aTc concentration gradient results in different sRNA Spot42 levels in cells when presented R0040, which can be monitored by our galK::GFP generator,where galK is the RBS of GFP and the target for Spot42. This device was mistaken for IPTG inducible sRNA device originally due to some ligation mistake,but we actually found this one is perfect to express full level sRNA to verify sRNA function without induction.When assembly the corresponding part together(constitutive Spot42 generator ligated to lacI generator),the double input platform will work efficiently. false false _986_ 0 14291 9 It's complicated false References: [1] Boris G??rke and J??rg Vogel, Noncoding RNA control of the making and breaking of sugars, GENES & DEVELOPMENT 22:2914???2925 ,2008 false Wenjie Wu and Peiran Zhang component2189846 1 BBa_P0440 component2189847 1 BBa_R0011 component2189852 1 BBa_K737058 component2189833 1 BBa_J23106 annotation2189847 1 BBa_R0011 range2189847 1 892 945 annotation2189852 1 BBa_K737058 range2189852 1 955 1063 annotation2189846 1 BBa_P0440 range2189846 1 44 883 annotation2189833 1 BBa_J23106 range2189833 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_P0440 1 BBa_P0440 PoPS -> TetR [S0151] 2004-04-26T11:00:00Z 2015-05-08T01:14:10Z Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Randy Rettberg component944902 1 BBa_B0010 component944896 1 BBa_C0040 component944912 1 BBa_B0012 component944886 1 BBa_B0034 annotation944896 1 BBa_C0040 range944896 1 19 678 annotation944886 1 BBa_B0034 range944886 1 1 12 annotation944912 1 BBa_B0012 range944912 1 800 840 annotation944902 1 BBa_B0010 range944902 1 712 791 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K737058 1 BBa_K737058 Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose 2012-09-18T11:00:00Z 2015-05-08T01:13:08Z No Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose operon and other sugar metabolic pathway,such as galK,nanC,ytfJ,srlA,which are the 5??? leader sequence of the corresponding metabolic enzymes. Take galK for example,Spot42 causes translation repression by base pairing to RBS in the 5??? leader sequence,then block the recognition of the antiSD sequence on 30S subunit. It???s a very strong pairing(up to 20bases),but it only causes 2.6 fold repression according to Johannes H. Urban and Jo?? rg Vogel,for it doesn???t result in the degradation of the RNA complex by RNaseE(ssRNA degradation) and RNaseIII(dsRNA degradation),both of them are major enzymes that causes RNA degradation in vivo.Spot42-galK complex degrades in a slow and presently unclear way. The base pairing is initiated by the recognition of seed region,which plays a significant role in the repression efficiency. Small RNA chaperone Hfq is an abundant protein that has 40000~50000 copies each cell,accelerating annealing and strand-exchange between small RNAs and target mRNA.Hfq binds to the AU-rich domain of small RNA,and footprinting experiments has shown that Hfq protects the degradation of RNA from RNase.It is essential to most of small RNAs in E.coli,extremely enchances the repression efficiency. Spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator(unclear efficiency,maybe weak),and the multitarget repression stem-loop. false false _986_ 0 14291 9 Not in stock true References: [1] Vandana Sharma, Asami Yamamura, and Yohei Yokobayashi,Engineering Artificial Small RNAs for Conditional Gene Silencing in Escherichia coli,ACS Synthetic Biology false Peiran Zhang BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K737042_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagaggtagggtacagaggtaagatgttctatctttcagaccttttacttcacgtaatcggatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta BBa_B0034_sequence 1 aaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_P0440_sequence 1 aaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_K737058_sequence 1 gtagggtacagaggtaagatgttctatctttcagaccttttacttcacgtaatcggatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z