BBa_K737048 1 BBa_K737048 The leading sequence involved in the nanC transcript which can act as the target of the sRNA, spot42 2012-09-18T11:00:00Z 2015-05-08T01:13:08Z No The leading sequence involved in the nanC transcript which can act as the target of the sRNA, spot42. It enables strong competition with the galk::GFP to interact with spot42 which shows great potential for constructing sRNA-mediated circuit. false false _986_ 0 14291 9 Not in stock false References: [1]Chase L. Beisel and Gisela Storz, The Base-Pairing RNA Spot 42 Participates in a Multioutput Feedforward Loop to Help Enact Catabolite Repression in Escherichia coli. Molecular Cell 41, 286???297, February 4, 2011 false Minghao Gong BBa_K737048_sequence 1 ccaagatagtcaatgagacagggcatctcgcaatctatggcaaacatcacttcagttctttctcatcgggtgatgaaaacgcacttcagtctgaaaggaatatgaaaatgagatcaacagacattctattttatgactctgggtaaaatggattgagtaagtgatatagcttacgaacattcaaatcaattaaacatcagaagagattttatactcaggtatttaatctggatctctgtttatttaaataatgtgaaaagagatttttcacaggagaccttatacaaaaaaatataaaatacagctaccggttgccaaagacactataagcctggcaaaaaaatattacacaacataaatgctaattgtttatgcgggctttgtattgctttctgtatcctacaaatgagtgaaatttatgaaaaaggctaaaatactttctggcgtattattactgtgcttttcgtccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z