BBa_K737057 1 BBa_K737057 Spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator(unclear efficiency 2012-09-18T11:00:00Z 2015-05-08T01:13:08Z No Spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator(unclear efficiency,maybe weak),and the multitarget repression stem-loop. This part contains the Hfq binding stem and terminator only. false false _986_ 0 14291 9 Not in stock false References: [1] Vandana Sharma, Asami Yamamura, and Yohei Yokobayashi,Engineering Artificial Small RNAs for Conditional Gene Silencing in Escherichia coli,ACS Synthetic Biology false Peiran Zhang BBa_K737057_sequence 1 atttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z