BBa_K737058 1 BBa_K737058 Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose 2012-09-18T11:00:00Z 2015-05-08T01:13:08Z No Spot42 is a multitarget small RNA that mediates the discoordinate expression of the E.coli galactose operon and other sugar metabolic pathway,such as galK,nanC,ytfJ,srlA,which are the 5??? leader sequence of the corresponding metabolic enzymes. Take galK for example,Spot42 causes translation repression by base pairing to RBS in the 5??? leader sequence,then block the recognition of the antiSD sequence on 30S subunit. It???s a very strong pairing(up to 20bases),but it only causes 2.6 fold repression according to Johannes H. Urban and Jo?? rg Vogel,for it doesn???t result in the degradation of the RNA complex by RNaseE(ssRNA degradation) and RNaseIII(dsRNA degradation),both of them are major enzymes that causes RNA degradation in vivo.Spot42-galK complex degrades in a slow and presently unclear way. The base pairing is initiated by the recognition of seed region,which plays a significant role in the repression efficiency. Small RNA chaperone Hfq is an abundant protein that has 40000~50000 copies each cell,accelerating annealing and strand-exchange between small RNAs and target mRNA.Hfq binds to the AU-rich domain of small RNA,and footprinting experiments has shown that Hfq protects the degradation of RNA from RNase.It is essential to most of small RNAs in E.coli,extremely enchances the repression efficiency. Spot42 have a weak Hfq binding site(whereas galK weaker),an endogenous terminator(unclear efficiency,maybe weak),and the multitarget repression stem-loop. false false _986_ 0 14291 9 Not in stock true References: [1] Vandana Sharma, Asami Yamamura, and Yohei Yokobayashi,Engineering Artificial Small RNAs for Conditional Gene Silencing in Escherichia coli,ACS Synthetic Biology false Peiran Zhang BBa_K737058_sequence 1 gtagggtacagaggtaagatgttctatctttcagaccttttacttcacgtaatcggatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z