BBa_K738000 1 D0 RNA Scaffold generator 2012-07-12T11:00:00Z 2015-05-08T01:13:08Z Dr. Camille J. Delebecque, the author of Organization of Intracellular Reactions with Rationally Designed RNA Assemblies, offer us D0 secquence in plsmid backbone pETDuet-BB. Scaffold D0 was constructed from a single RNA module d0, which folded into a duplex with PP7 and MS2 aptamer domains that bind PP7 and MS2 fusion proteins false false _987_ 0 11753 9 It's complicated false The part is design with biobrick assmebly standard 10, which has standard prefix and suffix. false Huachun Liu annotation2179306 1 T7 range2179306 1 1 18 annotation2179307 1 MS2 aptamer range2179307 1 29 42 annotation2195892 1 T7 terminator range2195892 1 121 171 annotation2195889 1 PP7 aptamer range2195889 1 63 87 BBa_K738000_sequence 1 ttaatacgactcactatagggaggactcccacagtcactggggagtcctcgaatacgagctgggcacagaagatatggcttcgtgcccaggaagtgttcgcacttctctcgtattcgattcccctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z