BBa_K740000 1 BBa_K740000 Constitutive promoter flanked by two loxP sites 2012-09-22T11:00:00Z 2015-05-08T01:13:08Z It was synthesized based on the sequence of J23115 and loxP site. This is a constitutive promoter (J23115) flanked by two opposite loxP sites so that it can flipped by Cre recombinase. false false _989_ 0 8529 9 It's complicated true We used 3 oligos to synthesize it. false Lei Wei annotation2193995 1 loxP range2193995 1 70 103 annotation2193992 1 J23115 range2193992 1 35 69 annotation2193991 1 loxP range2193991 1 1 34 BBa_K740000_sequence 1 ataacttcgtataatgtatgctatacgaagttattttatagctagctcagcccttggtacaatgctagcataacttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z