BBa_K741000 1 BBa_K741000 anticro 2012-07-22T11:00:00Z 2015-05-08T01:13:08Z BBa_I759002 You can use this DNA to produce an antisense RNA to inhibit the expression of the protein Cro from lambda phage. false false _990_ 0 11656 9 Not in stock false You need a promoter and a terminator but no RBS. false Wuyang Chen BBa_K741000_sequence 1 ttatgctgttgtttttttgttactcgggaagggctttacctcttccgcataaacgcttccatcagcgtttatagttaaaaaaatctttcggcctgcatgaatggccttgttgatcgcgctttgatatacgccgagatctttagctgtcttggtttgcccaaagcgcattgcataatctttcagggttatgcgttgttccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z