BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K741013 1 BBa_K741013 RBS-lysis-T 2012-07-24T11:00:00Z 2015-05-08T01:13:09Z BBa_B0034 BBa_K117000 BBa_B0015 Translation unit of lysis. false false _990_ 0 11656 9 Not in stock false TBD false Wuyang Chen component2178185 1 BBa_K117000 component2178192 1 BBa_B0015 component2178184 1 BBa_B0034 annotation2178184 1 BBa_B0034 range2178184 1 1 12 annotation2178192 1 BBa_B0015 range2178192 1 171 299 annotation2178185 1 BBa_K117000 range2178185 1 19 162 BBa_K117000 1 BBa_K117000 Lysis gene (promotes lysis in colicin-producing bacteria strain) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 This lysis gene encodes for the lysis protein in colicin-producing strains of bacteria. Once activated, it causes the host cell to lyze. It also removes the immunity protein out of colicin, and hence, activates the endonuclease activity of the colicin. false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K741013_sequence 1 aaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K117000_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z