BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K741013 1 BBa_K741013 RBS-lysis-T 2012-07-24T11:00:00Z 2015-05-08T01:13:09Z BBa_B0034 BBa_K117000 BBa_B0015 Translation unit of lysis. false false _990_ 0 11656 9 Not in stock false TBD false Wuyang Chen component2178185 1 BBa_K117000 component2178184 1 BBa_B0034 component2178192 1 BBa_B0015 annotation2178185 1 BBa_K117000 range2178185 1 19 162 annotation2178184 1 BBa_B0034 range2178184 1 1 12 annotation2178192 1 BBa_B0015 range2178192 1 171 299 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K741019 1 BBa_K741019 pRM-anticro-T-pRM-RBS-lysis-T 2012-08-28T11:00:00Z 2015-05-08T01:13:09Z BBa_K741016 BBa_K741014 If a lambda phage infects a bacteria, it will express protein CI and Cro. The CI will activate the promoter pRM and the anticro and the lysis(for E7 colicin) will be produced. The anticro is the antisense RNA of cro and can repress the expression of cro. The lysis can destroy the inner membrane and activate the OMPLA(Outer Membrane Phospholipase, an enzyme in many Gram-negative bacteria) to destroy the outer membrane. Then the host infected and the lambda phage will die. false false _990_ 0 11656 9 It's complicated true TBD false Wuyang Chen component2181235 1 BBa_K741016 component2181253 1 BBa_K741014 annotation2181253 1 BBa_K741014 range2181253 1 437 825 annotation2181235 1 BBa_K741016 range2181235 1 1 428 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937705 1 -10 range937705 1 71 76 annotation937702 1 OR2 range937702 1 33 49 annotation937701 1 OR1 range937701 1 9 25 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 annotation937703 1 -35 range937703 1 48 53 BBa_K741016 1 BBa_K741016 pRM-anticro-T 2012-08-17T11:00:00Z 2015-05-08T01:13:09Z BBa_I12007 BBa_K741000 BBa_B0015 The RNA polymerase will start transcripting the antisense RNA of cro if there is protein CI activated the promoter pRM. false false _990_ 0 11656 9 It's complicated true TBD false Wuyang Chen component2179888 1 BBa_K741000 component2179895 1 BBa_B0015 component2179887 1 BBa_I12007 annotation2179895 1 BBa_B0015 range2179895 1 300 428 annotation2179888 1 BBa_K741000 range2179888 1 91 291 annotation2179887 1 BBa_I12007 range2179887 1 1 82 BBa_K741000 1 BBa_K741000 anticro 2012-07-22T11:00:00Z 2015-05-08T01:13:08Z BBa_I759002 You can use this DNA to produce an antisense RNA to inhibit the expression of the protein Cro from lambda phage. false false _990_ 0 11656 9 Not in stock false You need a promoter and a terminator but no RBS. false Wuyang Chen BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K117000 1 BBa_K117000 Lysis gene (promotes lysis in colicin-producing bacteria strain) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 This lysis gene encodes for the lysis protein in colicin-producing strains of bacteria. Once activated, it causes the host cell to lyze. It also removes the immunity protein out of colicin, and hence, activates the endonuclease activity of the colicin. false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung BBa_K741014 1 BBa_K741014 pRM-RBS-lysis-T 2012-07-24T11:00:00Z 2015-05-08T01:13:09Z BBa_I12007 BBa_K741013 The protein lysis will be expressed if protein CI activates the promoter pRM. false false _990_ 0 11656 9 It's complicated true TBD false Wuyang Chen component2178209 1 BBa_K741013 component2178198 1 BBa_I12007 annotation2178198 1 BBa_I12007 range2178198 1 1 82 annotation2178209 1 BBa_K741013 range2178209 1 91 389 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K741014_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_K741000_sequence 1 ttatgctgttgtttttttgttactcgggaagggctttacctcttccgcataaacgcttccatcagcgtttatagttaaaaaaatctttcggcctgcatgaatggccttgttgatcgcgctttgatatacgccgagatctttagctgtcttggtttgcccaaagcgcattgcataatctttcagggttatgcgttgttccat BBa_K741019_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagttatgctgttgtttttttgttactcgggaagggctttacctcttccgcataaacgcttccatcagcgtttatagttaaaaaaatctttcggcctgcatgaatggccttgttgatcgcgctttgatatacgccgagatctttagctgtcttggtttgcccaaagcgcattgcataatctttcagggttatgcgttgttccattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K741013_sequence 1 aaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K741016_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagttatgctgttgtttttttgttactcgggaagggctttacctcttccgcataaacgcttccatcagcgtttatagttaaaaaaatctttcggcctgcatgaatggccttgttgatcgcgctttgatatacgccgagatctttagctgtcttggtttgcccaaagcgcattgcataatctttcagggttatgcgttgttccattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K117000_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z