BBa_K743002 1 PCaa3 PCaa3 promoter and native rbs from Synechocystis PCC6803 2012-09-19T11:00:00Z 2015-05-08T01:13:09Z this part was PCR amplified from Synechocystis chromosome, orf sll1898. Released HQ 2013 This is the 100bp sequence upstream the Caa3 gene start codon, it contains putative rbs and promoter regions. Caa3 codes for a putative cytochrome aa3 controlling protein and its mRNA levels have shown to oscillate in a circadian manner, peaking at hour 9. false false _994_ 0 11584 9 In stock false the desition of taking just 100bp upstream C false Juan Sim??n ??lamos annotation2188681 1 Pcaa3 promoter range2188681 1 1 101 BBa_K743002_sequence 1 atcaatcgcctagggcagggaaatctgaagtaaatctaaagaatattgatgctgtagccaagttttctttcccctggggagagtgttggttagaatctgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z