BBa_K743003 1 BBa_K743003 Pta promoter and native rbs from Synechocystis PCC6803 2012-09-19T11:00:00Z 2015-05-08T01:13:09Z This part was PCR amplified from Synechocystis chromosome, orf slr1739. This is the 150bp sequence upstream the Transaldolase gene start codon, it contains putative rbs and promoter regions. Transaldolase is an enzyme involved in the pentose phospate cycle and its mRNA levels have shown to oscillate in a circadian manner, peaking at hour 14. false false _994_ 0 11584 9 Not in stock false It was assumed that the 150bp sequence upstream from the start codon includes the promoter and the ribosome binding site false Juan Sim??n ??lamos annotation2188682 1 Pta range2188682 1 1 150 BBa_K743003_sequence 1 aacgcatcggcgttccctagcttaaattatcttgatgtccaaagaaggctcgctttcgggaatcaccattaccattggagggaaagacgttgaacttgtttaatcgccattatgggtaagaatctcctcgaacaactgcgccaatttaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z