BBa_K747092 1 BBa_K747092 TAL-Protein_TA6_Direpeat 2012-09-24T11:00:00Z 2015-05-08T01:13:11Z This Part was synthesized and flanked with BsmBI-restriction sites. Released HQ 2013 follows false false _998_ 0 13224 9 In stock false This protein domain can only be used within the TAL-effector-toolkit designed by the IGEM2012 Team Freiburg. The codon usage was modified to reduce homology in the sequence. A silent point mutation was inserted into the BsmBI restriction site in the chloramphenicol gene. false Lucas Schneider annotation2197070 1 TA 6 range2197070 1 14 211 BBa_K747092_sequence 1 cgtctcacctgaccccggaacaggtggtggccatcgcctccaacggcggtggcaaacaggcgctggaaacagttcaacgcctccttccggtcctgtgccaggcccatggtctgactccagagcaggttgtggcaattgcaagcaacattggtggtaaacaagctttggaaaccgtccagcgcttgctgccagtgctgtgtcaggcccacggactctgagacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z