BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K748007 1 BBa_K748007 Biofilm formation device. yddV gene with the IPTG inducible promoter. 2012-09-14T11:00:00Z 2015-05-08T01:13:12Z de novo synthesis &#12288;&#12288;Gene yddV is under the regulation of Ptrc promoter (IPTG-inducible). yddV is a Diguanylate Cyclase-Genomic. The product of gene yddV has diguanylate cyclase (DGC) activity. DGC uses 2 GTP to form a Bis-(3???-5???)-cyclic dimeric guanosine monophosphate (c-di-GMP). C-di-GMP is a global second messenger in bacteria. Biofilm formation of E.coli is manipulable by varying c-di-GMP concentrations. When the c-di-GMP level stays low, there is little biofilm and the bacteria is dispersive. High concentrations of c-di-GMP promote bacteria to form more cellulose and fimbriae, which enhances the biofilm formation and decrease the motility of bacteria. false false _999_ 0 8564 9 It's complicated true nothing special false Lei Qiao component2183402 1 BBa_K748003 component2183395 1 BBa_R0011 component2183409 1 BBa_B0015 component2183401 1 BBa_B0034 annotation2183395 1 BBa_R0011 range2183395 1 1 54 annotation2183401 1 BBa_B0034 range2183401 1 64 75 annotation2183409 1 BBa_B0015 range2183409 1 1476 1604 annotation2183402 1 BBa_K748003 range2183402 1 82 1467 BBa_K748003 1 BBa_K748003 yddV is a Diguanylate Cyclase-Genomic. 2012-09-14T11:00:00Z 2015-05-08T01:13:12Z de novo synthesis Released HQ 2013 yddV is a Diguanylate Cyclase-Genomic. The product of gene yddV has diguanylate cyclase (DGC) activity. DGC uses 2 GTP to form a Bis-(3???-5???)-cyclic dimeric guanosine monophosphate (c-di-GMP). C-di-GMP is a global second messenger in bacteria. Biofilm formation of E.coli is manipulable by varying c-di-GMP concentrations. When the c-di-GMP level stays low, there is little biofilm and the bacteria is dispersive. High concentrations of c-di-GMP promote bacteria to form more cellulose and fimbriae, which enhances the biofilm formation and decrease the motility of bacteria. false false _999_ 0 8564 9 In stock false nothing special false Lei Qiao BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation2000 1 -35 range2000 1 20 25 annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K748003_sequence 1 atggaaatgtattttaaacgtatgaaagatgaatggaccggtctggttgaacaagcagatcctccaattagagctaaagctgctgagatagcggtggctcacgctcactacttgagtatagagttttacagaatcgtacgaatcgatcctcacgctgaggagttcttgagtaacgaacaggtagagagacagttgaagagtgctatggagagatggataataaatgtactttctgcccaggtagacgacgtagaaagacttatacagatacagcacactgtagctgaagttcatgctagaataggaatacctgtagaaatagtagagatgggtttcagagtgcttaaaaagatattgtaccctgtaattttcagtagtgactacagtgctgctgagaagttgcaagtatatcacttttcaataaatagtatagacatagctatggaagtaatgactagagctttcactttctctgacagtagtgcttctaaagaggatgagaattacagaatattcagtcttcttgaaaacgctgaagaggaaaaagagagacaaatagcttctatattgagttgggaaattgacataatatacaagatacttcttgattctgatttgggcagtagtttgcctttgtctcaggctgacttcggcctttggttcaaccacaagggacgacactacttcagcggaatagctgaggtaggccatatatctcgacttatacaggatttcgatggaattttcaatcagacgatgagaaatacgagaaacttgaacaaccgttcattgagagtaaaattcttgcttcagataagaaacactgtgagccagataataactcttctacgagagttgttcgaggaggttagtcgacacgaggtaggcatggatgtgcttacgaaattgctaaacagacgattcttgccgaccatcttcaagagagagatagcgcacgctaaccgaactggcacgcctctttcggtattgatcatagatgtagataagttcaaagagataaatgacacatggggacataatactggtgatgaaatattgagaaaggtaagtcaagctttttacgataacgtacgaagttctgattacgttttcagatacggaggcgacgagttcataatagtgctaacggaagcttctgagaacgagacgcttcgaacggctgaaagaatacgtagtcgagtagaaaaaactaagttgaaggctgctaacggagaggatatagctttgagtctatctataggagctgctatgtttaacggacacccagattacgagcgacttatacagatagcggatgaggcactttacatagctaagagaagaggaagaaacagagtagagttgtggaaagctagtttgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_K748007_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggaaatgtattttaaacgtatgaaagatgaatggaccggtctggttgaacaagcagatcctccaattagagctaaagctgctgagatagcggtggctcacgctcactacttgagtatagagttttacagaatcgtacgaatcgatcctcacgctgaggagttcttgagtaacgaacaggtagagagacagttgaagagtgctatggagagatggataataaatgtactttctgcccaggtagacgacgtagaaagacttatacagatacagcacactgtagctgaagttcatgctagaataggaatacctgtagaaatagtagagatgggtttcagagtgcttaaaaagatattgtaccctgtaattttcagtagtgactacagtgctgctgagaagttgcaagtatatcacttttcaataaatagtatagacatagctatggaagtaatgactagagctttcactttctctgacagtagtgcttctaaagaggatgagaattacagaatattcagtcttcttgaaaacgctgaagaggaaaaagagagacaaatagcttctatattgagttgggaaattgacataatatacaagatacttcttgattctgatttgggcagtagtttgcctttgtctcaggctgacttcggcctttggttcaaccacaagggacgacactacttcagcggaatagctgaggtaggccatatatctcgacttatacaggatttcgatggaattttcaatcagacgatgagaaatacgagaaacttgaacaaccgttcattgagagtaaaattcttgcttcagataagaaacactgtgagccagataataactcttctacgagagttgttcgaggaggttagtcgacacgaggtaggcatggatgtgcttacgaaattgctaaacagacgattcttgccgaccatcttcaagagagagatagcgcacgctaaccgaactggcacgcctctttcggtattgatcatagatgtagataagttcaaagagataaatgacacatggggacataatactggtgatgaaatattgagaaaggtaagtcaagctttttacgataacgtacgaagttctgattacgttttcagatacggaggcgacgagttcataatagtgctaacggaagcttctgagaacgagacgcttcgaacggctgaaagaatacgtagtcgagtagaaaaaactaagttgaaggctgctaacggagaggatatagctttgagtctatctataggagctgctatgtttaacggacacccagattacgagcgacttatacagatagcggatgaggcactttacatagctaagagaagaggaagaaacagagtagagttgtggaaagctagtttgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z