BBa_K754000 1 BBa_K754000 <i>S. elongatus</i> PCC7942 <i>psbAI</i> promoter 2012-08-27T11:00:00Z 2015-05-08T01:13:12Z The sequence of this part comes from the AM 2195 plasmid developed by doctor Susan Golden. Our part is the Shynechococcus elongatus promoter PsbA, which in nature downregulates the expression for the Photosystem I components. This promoter works on a constitutive way, althought its activity can be enhanced or decreased in the presence or absence of light (in nature it works regulated in a circadian cicle). This part is suitable for building light-induced devices. false false _1005_ 0 13373 9 It's complicated true No special design consideration were taken during the biobrick designing. At any moment was necesarry because this fragment has no tarqet sequences for the standard restriction enzymes used and recomended by the parts registry. false iGEM Valencia 2012 annotation2202714 1 Functional binding site range2202714 1 191 246 annotation2181171 1 promoter range2181171 1 1 246 annotation2202723 1 atypical -10bp element TCTCCT range2202723 1 236 246 annotation2202722 1 AT rich sequence range2202722 1 196 216 BBa_K754000_sequence 1 ggactagaggctggatttagcgtcttctaatccagtgtagacagtagttttggctccgttgagcactgtagccttgggcgatcgctctaaacattacataaattcacaaagttttcgttacataaaaatagtgtctacttagctaaaaattaagggttttttacacctttttgacagttaatctcctagcctaaaaagcaagagtttttaactaagactcttgccctttacaacctcaagatcgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z