BBa_K755001 1 BBa_K755001 Standardized multiple cloning site 2012-10-10T11:00:00Z 2015-05-08T01:13:12Z synthesized sequenced based on iGEM standards The GSU standardized multiple cloning site (sMCS-1) is a short segment of double stranded DNA that can be customized to modify most commercially available vectors for insertion of iGEM biobricks. This linker includes the standard iGEM multiple cloning sites, in the appropriate order, with an Nhe1 site at the 3' end, to allow insertion at an existing Xba1 site and conversion of the Xba1/Nhe1 overlap into an uncut scar. false false _1006_ 0 12960 9 Not in stock false We wanted to eliminate an existing Xba1 site, replacing it with the appropriate sequence of restriction sites necessary for an iGEM compatible MCS. In synthesizing the linker, it was important to add extra sequence at each end to ensure that the restriction enzymes would cut at both the 3' and 5' ends. false Krystle McMinn BBa_K755001_sequence 1 tcatgatcatgaattccataagcggccgcaccctctagaaaaccctttactagtctttggcggccgcgaactgcagaatctgagctagctttctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z