BBa_K763001 1 BBa_K763001 pGroE + Gene encoding AsRed2 2012-09-06T11:00:00Z 2015-05-08T01:13:13Z The sequence of the promoter comes from E. coli genome, whereas the sequence encoding the AsRed2 fluorescent protein is not natural, since it was optimized for codon usage and maximum fluorescence production. Released HQ 2013 When the bacteria suffer heat shock the protein gets expressed. Why? Heat-shock response is mediated by the Sigma 32 factor. This alternative sigma factor lets the RNA polymerase binds to some consensus promoter sequence. groE has this sequence in the promoter. That is because this gene encodes a chaperon protein, GroE. Chaperone proteins are a group of proteins present in all cells, many of them are heat shock proteins, whose function is to assist the folding of other proteins in the newly formed protein synthesis. In the case of GroE, it processes a nonnative polypeptide in a cycle consisting of three steps. First, the polypeptide substrate is captured by GroEL. Upon binding of the co-chaperone GroES and ATP, the substrate is then discharged into a unique microenvironment inside of the chaperone, which promotes proper folding. After hydrolysis of ATP, the polypeptide is released into solution. Moreover, GroE may actively increase the folding efficiency, e.g. by unfolding of misfolded protein molecules. This chaperon has an important role in heat shock proccess too, helping other proteins not to denature. false false _1014_ 0 11756 9 In stock false No design considerations needed. false Pedro Luis Dorado Morales BBa_K763001_sequence 1 ccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcgatggcctctttgctgaagaagaccatgcccttcaggaccaccatcgagggcaccgtgaacggccactacttcaagtgcaccggcaagggcgagggcaaccccctggagggcacccaggagatgaagatcgaggtgatcgagggcggccccctgcccttcgccttccacatcctgtccacctcctgcatgtacggctccaaggccttcatcaagtacgtgtccggcatccccgactacttcaagcagtccctccccgagggcttcacctgggagcgcaccaccacctacgaggacggcggcttcctgaccgcccaccaggacacctccctggacggcgactgcctggtgtacaaggtgaagatcctgggcaacaacttccccgccgacggccccgtgatgcagaacaaggccggccgctgggagccctccaccgagatcgtgtacgaggtggacggcgtgctgcgcggccagtccctgatggccctggagtgccccggcggtcgccacctgacctgccacctgcacaccacctaccgctccaagaagcccgcctccgccctgaagatgcccggcttccacttcgaggaccaccgcatcgagatcctggaggaggtggagaagggcaagtgctacaagcagtacgaggccgccgtgggccgctactgcgacgccgccccctccaagctgggccacaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z