BBa_K763002 1 BBa_K763002 pNirB + Gene encoding ZsGreen1 2012-09-06T11:00:00Z 2015-05-08T01:13:13Z The sequence of the promoter comes from E. coli genome, whereas the sequence encoding the AmCyan fluorescent protein is not natural, since it was optimized for codon usage and maximum fluorescence production. Released HQ 2013 When our bacteria are growing in absence of oxygen, ZsYellow1 gets expressed. Why? FNR, is a DNA binding protein that regulates a large family of genes involved in cellular respiration and carbon metabolism during conditions of anaerobic cell growth. That is because FNR proteins are sensitive to little fluctuations in environmental oxygen concentration (FNR is believed to contain a redox/O2-sensitive element for detecting the anaerobic state). These proteins recognise a DNA target consisting of an inverted repeat: TTGATN1N2N3N4ATCAA (where N 1-4 represents a non-conserved tetrad, NCT). Then, when there is no oxygen in the media, FNR proteins bind to promoter and the transcription is activated false false _1014_ 0 11756 9 In stock false No design considerations needed. false Pedro Luis Dorado Morales BBa_K763002_sequence 1 attaaaggtgaatttgatttacatcaataagcggggttgctgaatcgttaaggtaggcggtaatagaaaagaaatcgaggcaaaaatggaagggtgcgtcgatggacataaatttgtgatcacgggagagggcattggatatccgttcaaagggaaacaggctattaatctgtgtgtggtcgaaggtggaccattgccatttgccgaagacatattgtcagctgcctttatgtacggaaacagggttttcactgaatatcctcaagacatagctgactatttcaagaactcgtgtcctgctggttatacatgggacaggtcttttctctttgaggatggagcagtttgcatatgtaatgcagatataacagtgagtgttgaagaaaactgcatgtatcatgagtccaaattttatggagtgaattttcctgctgatggacctgtgatgaaaaagatgacagataactgggagccatcctgcgagaagatcataccagtacctaagcaggggatattgaaaggggatgtctccatgtacctccttctgaaggatggtgggcgtttacggtgccaattcgacacagtttacaaagcaaagtctgtgccaagaaagatgccggactggcacttcatccagcataagctcacccgtgaagaccgcagcgatgctaagaatcagaaatggcatctgacagaacatgctattgcatccggatctgcattgccctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z