BBa_K763003 1 BBa_K763003 pGlnA + Gene encoding ZsYellow1 2012-09-06T11:00:00Z 2015-05-08T01:13:13Z The sequence of the promoter comes from E. coli genome, whereas the sequence encoding the AmCyan fluorescent protein is not natural, since it was optimized for codon usage and maximum fluorescence production. When there is no ammonia in the media the RNA-polimerase binds to RpoN Promoter and the transcription starts. Why? In gram-negative bacteria, transcriptional activation in response to some external stimuli (absence of nitrogen, for example) often involves the alternative sigma factor, Sigma 54. This factor, also called RpoN or Sigma N, was originally identified as the sigma factor for nitrogen-controlled genes. Sigma 54 works in conjunction with members of the NtrC (Nitrogen regulatory protein C) superfamily of transcriptional activators. ???RpoN Promoter??? contains a binding site which is recognized by the RNA-polimerase when Sigma 54 is binding to this protein. The polimerase binds to RpoN promoter which is present on genes/operons whose products minimize the slowing of growth under nitrogen-limiting conditions (aprox. 2% of the E. coli genome appears to be under NtrC control). false false _1014_ 0 11756 9 It's complicated false No design considerations needed. false Pedro Luis Dorado Morales BBa_K763003_sequence 1 ggtaatgaaccatcgtggtgcataccctccttttatagggcaggggaacgcgacagctgattaaaggagcaaatgacgaatctatcataatctcttatttgacagttggttagcttgtacatcaacaccaaaataaaactggcaagcatcttgcaatctggttgtaagtaatggcggcacttgggccgattcttaaaaaccggaggcaacatggaagggtgcgtcaacggacataaatttgtgatcacgggcgaaggcattggatatccgttcaaagggaaacagactattaatctgtgtgtgatcgaagggggaccattgccattttccgaagacatattgtcagctggctttaagtacggagacaggattttcactgaatatcctcaagacatagtagactatttcaagaactcgtgtcctgctggatatacatggggcaggtcttttctctttgaggatggagcagtctgcatatgcaatgtagatataacagtgagtgtcaaagaaaactgcatttatcataagagcatatttaatggagtgaattttcctgctgatggacctgtgatgaaaaagatgacaactaactgggaagcatcctgcgagaagatcatgccagtacctaagcaggggatactgaaaggggatgtctccatgtacctccttctgaaggatggtgggcgttaccggtgccagttcgacacagtttacaaagcaaagtctgtgccaagtaagatgccggagtggcacttcatccagcataagctcctccgtgaagaccgcagcgatgctaagaatcagaagtggcagctgacagagcatgctattgcattcccttctgccttggcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z