BBa_K764001 1 BBa_K764001 Plac promoter + RBS 2012-08-23T11:00:00Z 2015-05-08T01:13:13Z Biobricks registry 2012 distribution kit: Well no.: BBa_K094120 - 12E and BBa_B0034- 2M BBa_K094120 + BBa_B0034 false false _1015_ 0 12505 9 Not in stock false Parts combined using 3A assembly false Frederic Dudbridge component2180703 1 BBa_B0034 component2180701 1 BBa_K094120 annotation2180701 1 BBa_K094120 range2180701 1 1 103 annotation2180703 1 BBa_B0034 range2180703 1 112 123 BBa_K094120 1 BBa_K094120 pLacI/ara-1 2008-10-12T11:00:00Z 2015-05-08T01:08:40Z Standard pLacI/ara-1 promoter This promoter can be repressed by lacI protein and induced by either IPTG or arabinose. false false _255_ 0 2589 9 It's complicated false IPTG has better effect on this promoter than arabinose false Shi Lei annotation1980631 1 pLac/ara-1 range1980631 1 1 103 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K764001_sequence 1 catagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacagatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K094120_sequence 1 catagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z