BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K206001 1 BBa_K206001 pBAD weak 2009-10-16T11:00:00Z 2015-05-08T01:11:23Z Site-directed mutagenesis on <partinfo>I13453</partinfo> with the following primers: Forward: TAATCTTATGGATAAAAAAGCTATGGCATAGC Reverse: GCGGATCCTACCTGACGCTTTTTATC Released HQ 2013 Weaker version of wild type pBAD (<partinfo>I13453</partinfo>). false false _307_ 0 4172 9 In stock true No special considerations false Amelia Hardjasa annotation2049256 1 AraI1 range2049256 1 40 57 annotation2049257 1 AraI2 range2049257 1 61 78 annotation2049255 1 promoter range2049255 1 1 131 BBa_K764018 1 BBa_K764018 pBAD weak + BBa_B0034 2012-09-15T11:00:00Z 2015-05-08T01:13:13Z <partinfo>BBa_K206001</partinfo> + <partinfo> BBa_B0034</partinfo> pBAD weak + BBa_B0034 false false _1015_ 0 12505 9 Not in stock false 3A assembly false Frederic Dudbridge component2183494 1 BBa_B0034 component2183492 1 BBa_K206001 annotation2183492 1 BBa_K206001 range2183492 1 1 130 annotation2183494 1 BBa_B0034 range2183494 1 139 150 BBa_B0034_sequence 1 aaagaggagaaa BBa_K206001_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K764018_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z