BBa_K766007 1 BBa_K766007 Plas and cI hybrid promoter with RFP 2012-09-23T11:00:00Z 2015-05-08T01:13:14Z We hybrid Plas promoter and cI repressor by overlap PCR and add RFP downstream by another step of overlap PCR. This device is composed of a Plas/cI hybrid promoter and a translational unit of RFP. The Plas/cI hybrid promoter is made up of Plas promoter and cI operator. The promoter can be activated by the LasR-C12HSL complex and repressed by cI repressor. This part can be used in building some logic gates. The RFP segment is used as a signal to show the result of activation or repression. This kind fluorescent protein is very easy to be detected even by eyes. false false _1018_ 0 8494 9 It's complicated false We want to design a part that can be activated by one signal but repressed by another signal. false Yu Zhao annotation2195334 1 RFP range2195334 1 190 870 annotation2195331 1 Plas promoter and cI operator range2195331 1 1 163 annotation2195332 1 RBS range2195332 1 172 183 BBa_K766007_sequence 1 cccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacctctggcggtgataatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z