BBa_K771009 1 BBa_K771009 RNA－D0 2012-09-24T11:00:00Z 2015-05-08T01:13:14Z obtained from Prof. Leah Van Vaerenewyck RNA sequence which contains both MS2 and PP7 aptamer false false _1023_ 0 12097 9 In stock false For ''Membrane Switch'' false WU Yuqi annotation2203428 1 PP7 aptamer range2203428 1 77 101 annotation2203429 1 EcoN I range2203429 1 1 8 annotation2203427 1 T7 terminater range2203427 1 135 185 annotation2203426 1 MS2 aptamer range2203426 1 43 55 annotation2203425 1 T7 promoter range2203425 1 15 32 BBa_K771009_sequence 1 cctgcattaggaaattaatacgactcactatagggaggactcccacagtcactggggagtcctcgaatacgagctgggcacagaagatatggcttcgtgcccaggaagtgttcgcacttctctcgtattcgattcccctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z