BBa_K771104 1 BBa_K771104 ssDsbA-PDZligand 2012-09-23T11:00:00Z 2015-05-08T01:13:14Z Gene Synthesis components of interacting proteins false false _1023_ 0 12097 9 Not in stock false For Membrane Accelerator false Guo Huaqing annotation2213275 1 ssDsbA range2213275 1 22 78 annotation2213276 1 PDZ Ligand range2213276 1 79 99 annotation2213274 1 rbs range2213274 1 5 13 BBa_K771104_sequence 1 aaaaataaggaggaaaaaaaaatgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgggcgtgaaggaatctctggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z